Em formação

Os snRNAs saem do núcleo ou não?

Os snRNAs saem do núcleo ou não?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

No Biologia molecular da célula (Alberts, et al., 2015), ele lista os vários RNAs que são traficados através do Complexo de Poros Nucleares (NPC) para o citoplasma.

A lista inclui snRNAs, mas já vi em outro lugar que os snRNAs não saem do núcleo, que são feitos lá e desempenham sua função lá.

A versão do MBOC está correta e os snRNAs saem do núcleo ou as outras fontes estão corretas e os snRNAs são feitos, permanecem e funcionam no núcleo?


Após a transcrição de alguns UsnRNAs, os RNAs deixam os núcleos primeiro. Após a montagem de várias proteínas e modificação nos RNAs do citosol, os RNAs voltam aos núcleos. Além disso, foi demonstrado que o U6snRNP maduro alterna entre as frações nucleares e citosólicas em leveduras, se bem me lembro.

http://openi.nlm.nih.gov/detailedresult.php?img=2582628_gkn658f1&req=4


Papel dos fatores do hospedeiro no tráfico subcelular de proteínas Gag e RNA genômico que leva à montagem do vírion

Eunice C. Chen, Leslie J. Parent, em Retrovirus-Cell Interactions, 2018

Exportação nuclear de RNA de spumaretrovirus

A exportação nuclear do genoma viral em spumaretrovírus, como protótipo de vírus espumoso (PFV), utiliza um mecanismo que é uma mistura de retrovírus simples e complexos (Fig. 8.1). A exportação nuclear em PFV é dependente de Crm1, conforme evidenciado pela expressão diminuída de Gag em células 293T infecciosas transfectadas com pró-vírus após tratamento com leptomicina B (LMB) (Bodem et al., 2011). No entanto, o PFV não codifica uma proteína viral que interage com Crm1. Em vez disso, o PFV depende de uma proteína de ligação de RNA celular HuR e proteínas adaptadoras ANP32A / B para fazer a ponte entre o genoma viral e Crm1. Acredita-se que essa interação seja direta, já que foi identificada por técnicas de ligação cruzada RNA-proteína e imunoprecipitação entre o genoma viral e as proteínas marcadas. No entanto, os mecanismos dessa interação não estão totalmente esclarecidos, uma vez que a estrutura secundária do RNA comumente necessária para interações HuR-RNA não foi identificada no RNA de PFV (Bodem et al., 2011 Prechtel et al., 2006).


Biogênese de snRNPs spliceossômicos

Com exceção de U6, os principais snRNAs spliceosomais (U1, U2, U4 e U5) são sintetizados por Pol II. Os snRNAs específicos de Pol-II adquirem uma estrutura cap de monometil guanosina (7mGpppG) e seus transcritos primários são estendidos muito além da extremidade 3 'do RNA maduro. Intermediários pré-snRNA estáveis ​​carregando apenas uma pequena saliência (5-10 nt) 3 'são gerados por um evento de processamento ligado à transcrição que requer uma sequência de sinal de ação cis (caixa 3') e fosforilação do domínio C-terminal do maior subunidade de Pol II (Medlin et al., 2003). O presnRNA é montado em um grande complexo de exportação que inclui o complexo 7mG-cap-binding (CBC), o adaptador fosforilado para exportação de RNA (PHAX) e o complexo CRM1 / RanGTP. Após a exportação para o citoplasma através do complexo de poro nuclear (NPC), a desfosforilação de PHAX e a hidrólise de GTP de Ran induzem a desmontagem do complexo de exportação de snRNA (Ohno et al., 2000).

No citoplasma, o complexo de proteínas de sobrevivência de neurônios motores (SMN) facilita a montagem de pré-snRNA com um anel heteroheptamérico de sete proteínas Sm - B / B ′, D1, D2, D3, E, F e G - para formar o complexo central snRNP (Paushkin et al., 2002). As proteínas Sm ligam-se ao sítio de ligação de Sm conservado (Sm, consenso RAUU U /GUUGR) de snRNAs spliceossomais específicos de Pol-II. A ligação de proteínas Sm é um pré-requisito para a hipermetilação do cap 7mG em 2,2,7-trimetilguanosina (TMG) pela metiltransferase Tgs1, bem como para a remoção exonucleolítica das sequências 3 '. O cap TMG recentemente sintetizado e as proteínas Sm associadas fornecem o sinal de localização nuclear para o núcleo citoplasmático snRNP. A reimportação de Sm snRNPs para o núcleo é mediada por três fatores: snurportin-1 (SPN1), que reconhece o cap TMG do snRNA importina β, que se associa com SPN1 e um receptor de importação não identificado que interage com proteínas Sm (Sm IR) ( Palacios et al., 1997).

Após a reentrada no nucleoplasma, as proteínas de importação se dissociam e os snRNPs recém-importados se acumulam transitoriamente nos corpos de Cajal (Sleeman e Lamond, 1999). No corpo Cajal, os snRNAs U1, U2, U4 e U5 sofrem pseudouridilação específica do local (Ψ) e 2′-O-metilação (m) dirigida por scaRNAs, que se acumulam especificamente em corpos Cajal (Jády et al., 2003) . Além das proteínas centrais Sm comuns, os snRNPs U1, U2, U4 e U5 maduros também contêm proteínas RNP específicas da espécie. Uma vez que as proteínas específicas do snRNP parecem se concentrar nos corpos de Cajal, acredita-se que elas se associem aos snRNPs centrais nesta organela.

Finalmente, os snRNPs spliceossômicos maduros se acumulam na região da intercromatina em estruturas chamadas manchas de splicing. Normalmente, as manchas estão localizadas perto de genes ativamente transcritos. Eles provavelmente fornecem locais de armazenamento para snRNPs ou funcionam na reciclagem de snRNP (Lamond e Spector, 2003). É importante notar que vários laboratórios relataram baixos níveis de localização nucleolar de Sm snRNPs sob várias condições (Gerbi et al., 2003 Sleeman e Lamond, 1999). Infelizmente, a importância funcional do acúmulo transitório de Sm snRNAs no nucléolo permanece conjetural. A biogênese dos snRNPs spliceossômicos menores específicos de Pol-II, U12 e U4atac, provavelmente segue a via de maturação dos snRNPs Sm principais.

Em contraste com os snRNAs Sm específicos de Pol-II, a biogênese do snRNA U6 transcrito por Pol-III está confinada ao núcleo. Antes de se acumular nas manchas de splicing nucleoplasmático, o snRNA U6 em maturação visita o nucléolo e o corpo de Cajal. A síntese de U6 snRNA termina dentro de um pequeno trecho U que serve como um sinal de terminação da transcrição para Pol III. O trecho U do terminal 3 'do RNA U6 recém-sintetizado se associa transitoriamente com a proteína La, que fornece estabilidade para o RNA nascente e facilita a montagem do snRNP (Wolin e Cedervall, 2002). Mais tarde, a proteína La é substituída pelo heterômero do tipo donut de sete proteínas do tipo Sm (Lsm2, Lsm3, Lsm4, Lsm5, Lsm6, Lsm7 e Lsm8) (Achsel et al., 1999). A estrutura do anel Lsm ainda não é conhecida.

Durante sua maturação, o U6 snRNA também sofre pseudouridilação específica do local e 2'-O-metilação. No entanto, em contraste com os snRNAs Sm, que são modificados por scaRNPs no corpo de Cajal, a 2′-O-metilação e provavelmente também a pseudouridilação do snRNA U6 é dirigida por snoRNAs, que residem no nucléolo. Isso indica que o U6 percorre o nucléolo para sofrer modificações mediadas por snoRNA (Ganot et al., 1999 Lange e Gerbi, 2000). A ligação do complexo proteico Lsm é essencial para o direcionamento do U6 snRNA para o nucléolo e, posteriormente, para o corpo de Cajal (Gerbi e Lange, 2002). Os snRNPs U6 e U4 maduros existem em um disnRNP U4-U6 comum que também liga o snRNP U5 para formar o tri-snRNP U4-U6-U5. A recente descoberta de que SART3 / p110, um fator de proteína que facilita a montagem de U4-U6, está concentrado no corpo de Cajal sugere que a montagem do U4-U6 snRNP pode ocorrer nesta organela (Stanek et al., 2003). Não está claro se o U5 snRNP se junta ao U4-U6 di-snRNP no corpo de Cajal ou posteriormente no nucleoplasma. O snRNA U6 maduro carrega uma estrutura de capa γ-monometilfosfato (mpppG) (Singh e Reddy, 1989), mas permanece desconhecido em que estágio da biogênese U6 o cap mpppG é sintetizado.


Referências

Golgi, C. Sur la structure des cellules nervus. Arco. Ital. Biol. 30, 60–71 (1898).

Cajal, S. R. y. Un sencillo metodo de coloracion selectiva del reticulo protoplasmatico y sus efectos en los diversos organos nerviosos de vertebrados and invertebrados. Trab. Lab. Investir. Biol. (Madrid) 2, 129–221 (1903).

Gall, J. G., Bellini, M., Wu, Z. & amp Murphy, C. Montagem da transcrição nuclear e maquinaria de processamento: corpos de Cajal (corpos em espiral) e transcriptossomas. Mol. Biol. Célula 10, 4385–4402 (1999).

Jörgensen, M. & amp Zellenstudien, I. Morphologische Beiträge zum Problem des Eiwachstums. Arco. Zellforsch. 10, 1–126 (1913).

Bier, K., Kunz, W. & amp Ribbert, D. Struktur und Funktion der Oocytenchromosomen und Nukleolen sowie der Extra-DNS während der Oogenese panoistischer und meroistischer Insekten. Cromossomo 23, 214–254 (1967).

Gall, J. G. Lampbrush chromosomes from the oocyte nuclei of the newt. J. Morphol. 94, 283–352 (1954).

Callan, H. G. Trabalhos recentes sobre a estrutura dos núcleos celulares. no Estrutura fina das células: Simpósio do VIII Congresso de Biologia Celular, Leiden 1954, Publicação da União Internacional de Ciências Biológicas, Série B 21, 89–109 (1954).

Gall, J.G., Stephenson, E.C., Erba, H.P., Diaz, M.O. & amp Barsacchi-Pilone, G. Os genes de histona estão localizados nos loci da esfera de cromossomos de escova de lâmpada de salamandra. Cromossomo 84, 159–171 (1981).

Callan, H. G., Gall, J. G. & amp Murphy, C. Os genes de histona estão localizados na esfera loci de Xenopus cromossomos lampbrush. Cromossomo 101, 245–251 (1991).

Gall, J. G. & amp Callan, H. G. A organela da esfera contém pequenas ribonucleoproteínas nucleares. Proc. Natl Acad. Sci. EUA 86, 6635–6639 (1989).

Wu, Z., Murphy, C., Callan, H. G. & amp Gall, J. G. Small nuclear ribonucleoproteins and heterogeneous nuclear ribonucleoproteins in the anfibian germinal vesicle: loops, spheres, and snurposomes. J. Cell Biol. 113, 465–483 (1991).

Wu, C. -H. H. & amp Gall, J. G. U7 small nuclear RNA in C snurposomes of the Xenopus vesícula germinativa. Proc. Natl Acad. Sci. EUA 90, 6257–6259 (1993).

Wu, C. -H. H., Murphy, C. & amp Gall, J. G. O sítio de ligação Sm direciona U7 snRNA para corpos enrolados (esferas) de oócitos anfíbios. RNA 2, 811–823 (1996).

Frey, M. R. & amp Matera, A. G. Os corpos em espiral contêm U7 RNA nuclear pequeno e associam-se a sequências de DNA específicas em células humanas em interfase. Proc. Natl Acad. Sci. EUA 92, 5915–5919 (1995).

Monneron, A. & amp Bernhard, W. Organização estrutural fina do núcleo interfase em algumas células de mamíferos. J. Ultrastruct. Res. 27, 266–288 (1969).

Hardin, J. H., Spicer, S. S. & amp Greene, W. B. A estrutura paranucleolar, corpo acessório de Cajal, cromatina sexual e estruturas relacionadas em núcleos de neurônios trigêmeos de rato: um estudo citoquímico e ultraestrutural. Anat. Gravando. 164, 403–432 (1969).

Lafarga, M. & amp Hervas, J. P. em A contribuição de Ramon y Cajal para as neurociências (eds Grisolia, S., Guerri, C., Samson, F., Norton, S. & amp Reinoso-Suárez, F.) 91-100 (Elsevier Science Publishers, 1983).

Fakan, S., Leser, G. & amp Martin, T. E. Distribuição ultraestrutural de ribonucleoproteínas nucleares conforme visualizado por imunocitoquímica em seções finas. J. Cell Biol. 98, 358–363 (1984).

Lafontaine, J. G. Um estudo microscópico de luz e eletrônico de pequenos corpos nucleares esféricos em células meristemáticas de Allium cepa, Vicia faba, e Raphanus sativus. J. Cell Biol. 26, 1–17 (1965).

Chamberland, H. & amp Lafontaine, J. G. Localização de antígenos snRNP em corpos associados ao nucléolo: estudo de núcleos de interfase de plantas por microscopia confocal e eletrônica. Cromossomo 102, 220–226 (1993).

Ras̆ka, I. et al. Estudos imunológicos e ultraestruturais do corpo espiralado nuclear com anticorpos auto-imunes. Exp. Cell Res. 195, 27–37 (1991).

Andrade, L.E.C. et al. Autoanticorpo humano para uma nova proteína do corpo espiralado nuclear: caracterização imunológica e clonagem de cDNA da p80-coilina. J. Exp. Med. 173, 1407–1419 (1991).

Beven, A. F., Simpson, G. G., Brown, J. W. S. & amp Shaw, P. J. The organization of spliceosomal components in the nuclei of higher plants. J. Cell Sei. 108, 509–518 (1995).

Tuma, R. S., Stolk, J. A. & amp Roth, M. B. Identificação e caracterização de uma proteína de organela de esfera. J. Cell Biol. 122, 767–773 (1993).

Wu, Z., Murphy, C. & amp Gall, J.G. Human p80-coilin é direcionado para organelas esféricas na vesícula germinativa de anfíbio. Mol. Biol. Célula 5, 1119–1127 (1994).

Gall, J. G., Tsvetkov, A., Wu, Z. & amp Murphy, C. A organela da esfera / corpo espiralado é um componente nuclear universal? Dev. Genet. 16, 25–35 (1995).

Bauer, D. W. & amp Gall, J. G. Coiled corpos sem bobina. Mol. Biol. Célula 8, 73–82 (1997).

Tucker, K. E. et al. Corpos de Cajal residuais em camundongos knockout para coilin não conseguem recrutar Sm snRNPs e SMN, o produto do gene da atrofia muscular espinhal. J. Cell Biol. 154, 293–307 (2001).

Bellini, M. Coilin, mais do que um marcador molecular do corpo Cajal (enrolado). Bioessays 22, 861–867 (2000).

Carmo-Fonseca, M. et al. Os núcleos de mamíferos contêm focos altamente enriquecidos em componentes da maquinaria de splicing do pré-mRNA. EMBO J. 10, 195–206 (1991).

Carmo-Fonseca, M., Pepperkok, R., Carvalho, M. T. & amp Lamond, A. I. Colocalização dependente da transcrição dos snRNPs U1, U2, U4 / U6 e U5 em corpos enrolados. J. Cell Biol. 117, 1–14 (1992).

Huang, S. & amp Spector, D. L. U1 e U2 pequenos RNAs nucleares estão presentes em manchas nucleares. Proc. Natl Acad. Sci. EUA 89, 305–308 (1992).

Matera, A. G. & amp Ward, D. C. Nucleoplasmic organization of small nuclear ribonucleoproteins in cultivured human cells. J. Cell Biol. 121, 715–727 (1993).

Lamond, A. I. & amp Earnshaw, W. C. Structure and function in the nucleus. Ciência 280, 547–553 (1998).

Matera, A. G. Nuclear corpos: subdomínios multifacetados do espaço interchromatin. Trends Cell Biol. 9, 302–309 (1999).

Gall, J. G. Cajal corpos: os primeiros 100 anos. Annu. Rev. Cell Dev. Biol. 16, 273–300 (2000).

Liu, Q. & amp Dreyfuss, G. Uma nova estrutura nuclear contendo a sobrevivência da proteína dos neurônios motores. EMBO J. 15, 3555–3565 (1996).

Schul, W. et al. Os fatores de clivagem do RNA 3 'CstF 64 kDa e CPSF 100 kDa estão concentrados em domínios nucleares intimamente associados a corpos enrolados e RNA sintetizado recentemente. EMBO J. 15, 2883–2892 (1996).

Schul, W., van Driel, R. & amp de Jong, L. Coiled corpos e U2 snRNA genes adjacentes a corpos enrolados são enriquecidos em fatores necessários para a transcrição de snRNA. Mol. Biol. Célula 9, 1025–1036 (1998).

Darzacq, X. et al. Pequenos RNAs nucleares específicos do corpo de Cajal: uma nova classe de 2′-O- RNAs de guia de metilação e pseudouridilação. EMBO J. 21, 2746–2756 (2002).

Richard, P. et al. Um motivo de sequência comum determina a localização específica do corpo de Cajal dos scaRNAs H / ACA da caixa. EMBO J. 22, 4283–4293 (2003).

Jády, B. E. & amp Kiss, T. Um pequeno RNA guia nucleolar funciona tanto em 2′-O-ribose metilação e pseudouridilação do U5 spliceosomal RNA. EMBO J. 20, 541–551 (2001).

Samarsky, D. A., Fournier, M. J., Singer, R. H. & amp Bertrand, E. O motivo snoRNA box C / D direciona o direcionamento nucleolar e também acopla a síntese e localização de snoRNA. EMBO J. 17, 3747–3757 (1998).

Carvalho, T. et al. O produto do gene da doença da atrofia muscular espinhal, SMN: uma ligação entre a biogênese do snRNP e o corpo de Cajal (enrolado). J. Cell Biol. 147, 715–727 (1999).

Narayanan, A., Speckmann, W., Terns, R. & amp Terns, M.P. Role of the box C / D motif in localization of small nucleolar RNAs to coiled corpos and nucleoli. Mol. Biol. Célula 10, 2131–2147 (1999).

Sleeman, J. E. & amp Lamond, A. I. SnRNPs recém-montados associam-se a corpos em espiral antes de manchas, sugerindo uma via de maturação de snRNP nuclear. Curr. Biol. 9, 1065–1074 (1999).

Handwerger, K. E., Murphy, C. & amp Gall, J. G. Steady-state dynamics of Cajal body components in the Xenopus vesícula germinativa. J. Cell Biol. 160, 495–504 (2003).

Sleeman, J. E., Trinkle-Mulcahy, L., Prescott, A. R., Ogg, S. C. & amp Lamond, A. I. As proteínas do corpo de Cajal SMN e coilin mostram comportamento dinâmico diferencial na Vivo. J. Cell Sei. 116, 2039–2050 (2003).

Boudonck, K., Dolan, L. & amp Shaw, P. J. O movimento de corpos enrolados visualizados em células de plantas vivas pela proteína fluorescente verde. Mol. Biol. Célula 10, 2297–2307 (1999).

Platani, M., Goldberg, I., Swedlow, J. R. & amp Lamond, A. Na Vivo análise do movimento do corpo Cajal, separação e união em células humanas vivas. J. Cell Biol. 151, 1561–1574 (2000).

Platani, M., Goldberg, I., Lamond, A. I. & amp Swedlow, J.R. Cajal body dynamics and association with chromatin são ATP-dependentes. Nature Cell Biol. 4, 502–508 (2002).

Verheggen, C. et al. Os snoRNPs U3 de mamíferos e leveduras são maturados em compartimentos nucleares específicos e relacionados. EMBO J. 21, 2736–2745 (2002).

Jády, B.E. et al. A modificação de pequenos RNAs nucleares Sm ocorre no corpo nucleoplasmático do Cajal após a importação do citoplasma. EMBO J. 22, 1878–1888 (2003).

Verheggen, C. et al. O tráfego de RNA nucleolar pequeno na Caixa C / D envolve proteínas RNP nucleolares pequenas, fatores nucleolares e um novo domínio nuclear. EMBO J. 20, 5480–5490 (2001).

Meister, G. & amp Fischer, U. Assisted RNP assembly: SMN e PRMT5 complexes cooperam na formação de spliceosomal UsnRNPs. EMBO J. 21, 5853–5863 (2002).

Pellizzoni, L., Yong, J. & amp Dreyfuss, G. Essential role for the SMN complex in the specificity of snRNP assembly. Ciência 298, 1775–1779 (2002).

Hebert, M. D., Szymczyk, P. W., Shpargel, K. B. & amp Matera, A. G. Coilin forma a ponte entre os corpos de Cajal e SMN, a proteína de atrofia muscular espinhal. Genes Dev. 15, 2720–2729 (2001).

Cajal, S. R. y. El núcleo de las células piramidales del cerebro human y de algunos mamiferos. Trab. Lab. Investir. Biol. Univ. Madrid 8, 27–62 (1910).

Bellini, M. & amp Gall, J.G. Coilin pode formar um complexo com a ribonucleoproteína nuclear pequena U7. Mol. Biol. Célula 9, 2987–3001 (1998).

Smith, K. P., Carter, K. C., Johnson, C. V. & amp Lawrence, J. B. U2 e U1 snRNA gene loci associam com corpos enrolados. J. Cell. Biochem. 59, 473–485 (1995).

Zhu, Y., Tomlinson, R. L., Lukowiak, A. A., Terns, R. M. & amp Terns, M. P. Telomerase RNA acumula-se em corpos de Cajal em células cancerosas humanas. Mol. Biol. Célula 3 Outubro de 2003 [epub antes da impressão].


DMCA Complaint

Se você acredita que o conteúdo disponível por meio do Site (conforme definido em nossos Termos de Serviço) viola um ou mais de seus direitos autorais, notifique-nos fornecendo um aviso por escrito ("Aviso de Violação") contendo as informações descritas abaixo para o designado agente listado abaixo. Se Varsity Tutors tomar medidas em resposta a um Aviso de Infração, ele fará uma tentativa de boa fé para entrar em contato com a parte que disponibilizou tal conteúdo por meio do endereço de e-mail mais recente, se houver, fornecido por tal parte aos Tutores do Varsity.

Seu Aviso de violação pode ser encaminhado para a parte que disponibilizou o conteúdo ou para terceiros, como ChillingEffects.org.

Informamos que você será responsabilizado por danos (incluindo custos e honorários advocatícios) caso expresse indevidamente que um produto ou atividade está infringindo seus direitos autorais. Portanto, se você não tiver certeza de que o conteúdo localizado ou vinculado ao site viola seus direitos autorais, você deve primeiro entrar em contato com um advogado.

Siga estas etapas para registrar um aviso:

Você deve incluir o seguinte:

Uma assinatura física ou eletrônica do proprietário dos direitos autorais ou de uma pessoa autorizada a agir em seu nome Uma identificação dos direitos autorais alegados como tendo sido violados Uma descrição da natureza e localização exata do conteúdo que você alega violar seus direitos autorais, em suficiente detalhes para permitir que os tutores do time do colégio encontrem e identifiquem positivamente esse conteúdo, por exemplo, exigimos um link para a questão específica (não apenas o nome da questão) que contém o conteúdo e uma descrição de qual parte específica da questão - uma imagem, um link, o texto, etc - sua reclamação refere-se ao seu nome, endereço, número de telefone e endereço de e-mail e uma declaração sua: (a) que você acredita de boa fé que o uso do conteúdo que você alega infringir seus direitos autorais é não autorizado por lei, ou pelo proprietário dos direitos autorais ou agente do proprietário (b) que todas as informações contidas em seu Aviso de violação são precisas e (c) sob pena de perjúrio, que você é o proprietário dos direitos autorais ou uma pessoa autorizada a agir em seu nome.

Envie sua reclamação para o nosso agente designado em:

Charles Cohn Varsity Tutors LLC
101 S. Hanley Rd, Suíte 300
St. Louis, MO 63105


Agradecemos a Karla Neugebauer, Edouard Bertrand, David Drechsel, Angus Lamond, Yaron Shav-Tal, Pavel Draber e Maria Carmo-Fonseca por nos fornecerem reagentes e Gabi Heyne pela excelente assistência técnica. Agradecemos aos membros do laboratório Stanek pela leitura crítica.

Contribuição do Autor: A.R. projetou e executou a maioria dos experimentos (Figuras 1– 6) e participou da redação do manuscrito C.W. isolou 12S, 15S e 17S U2 snRNPs, C.G. núcleo preparado e microinjetado, partículas de snRNP pré-maduras e maduras (Figuras 5 e 7) K.K. preparou U4snRNA-MS2 mínimo e realizou imunoprecipitação com U4-MS2, U2-MS2 construtos e mutantes Sm e participou da redação do manuscrito J.P. realizou a previsão da estrutura de snRNA e D.S., R.L. e C.G. projetou e avaliou experimentos e escreveu o manuscrito.


RNAs nucleares pequenos recentemente sintetizados aparecem transitoriamente no citoplasma ☆

As espécies Ul e U2 de pequenos RNA nucleares (snRNA) recentemente sintetizados são facilmente identificadas em frações citoplasmáticas preparadas por fracionamento celular aquoso padrão. No entanto, como as espécies de snRNA maduras estáveis ​​vazam dos núcleos isolados durante o fracionamento celular, existe a possibilidade de que essas espécies recém-sintetizadas também vazem do núcleo. Para superar os problemas de vazamento nuclear, células L929 de camundongo foram fracionadas por enucleação celular. A enucleação expulsa os núcleos das células tratadas com citocalasina e produz citoplastos que, por vários critérios, são um genuíno fração citoplasmática não contaminada por material nuclear. Todos os seis dos principais snRNAs estão presentes nos citoplastos (c-snRNAs) logo após a síntese. As espécies são identificadas por imunoprecipitação com anti-soros específicos contra as ribonucleoproteínas e por Northern blotting e seleção de híbridos usando sondas clonadas. Isso confirma e estende estudos semelhantes que usaram fracionamento de células não aquosas e dissecção manual para superar o vazamento nuclear. Estudos cinéticos demonstram que os c-snRNAs retornam ao núcleo da interfase após aproximadamente 20 minutos no citoplasma. O precursor U2 U2 ′ é processado em U2 de tamanho maduro nas frações do citoplasto antes de retornar ao núcleo. Os c-snRNAs ocorrem em partículas de ribonucleoproteína com antigenicidade semelhante às partículas nucleares maduras em seis minutos após a transcrição. Isso sugere que, em células de mamíferos, etapas importantes na montagem dessas ribonucleoproteínas ocorrem no citoplasma.


Dinâmica celular de pequenos RNAs

Esta revisão destaca a saída nuclear inesperadamente complicada e a importação nuclear de pequenos RNAs. Embora o tráfego de núcleo / citoplasma fosse considerado restrito a snRNAs de muitos, mas não todos, eucariotos, dados recentes indicam que esse tráfego pode ser mais comum do que anteriormente apreciado. Em primeiro lugar, em conflito com vários relatórios anteriores, novas informações indicam que os snRNAs de Saccharomyces cerevisiae podem circular entre o núcleo e o citoplasma. Em segundo lugar, estudos recentes também fornecem evidências de que outros pequenos RNAs que funcionam exclusivamente no núcleo - o RNA da telomerase de levedura e possivelmente pequenos RNAs nucleolares - podem sair para o citoplasma, apenas para retornar ao núcleo. Terceiro, o ciclo de núcleo / citoplasma de RNAs também ocorre para RNAs que funcionam apenas no citoplasma, pois foi descoberto que tRNAs citoplasmáticos de levedura de brotamento viajam "retrógrados" para o núcleo e, talvez, de volta ao citoplasma para funcionar na proteína síntese. Quarto, há pelo menos um exemplo em ciliados de pequenos RNAs de fita dupla viajando em vários ciclos entre o citoplasma e núcleos distintos para direcionar a estrutura do genoma. Este relatório discute dados que apóiam ou argumentam contra o movimento bidirecional do núcleo / citoplasma para cada categoria de RNA pequeno e os possíveis papéis que esse movimento pode desempenhar.


Materiais e métodos

Cultura de células tsBN2, hibridização fluorescente in situ e imunofluorescência

A linha de células mutantes RCC1 sensível à temperatura, tsBN2 (Ohtsubo et al., 1987), foi cultivada em meio Eagle modificado de Dulbecco (Sigma) suplementado com 10% de soro fetal bovino a 33 ° C. A localização do U3 snoRNA na temperatura permissiva (33 ° C) e não permissiva (40 ° C) foi determinada por hibridização fluorescente in situ (FISH), conforme descrito em outro lugar (http://singerlab.aecom.yu.edu/ protocolos). Resumidamente, as células foram semeadas em lamelas em aproximadamente 80% de confluência e permitidas aderir durante a noite e, em seguida, metade dessas lamelas foram deslocadas para 40 ° C. As células foram fixadas em formaldeído a 4% (Eletron Microscopy Science), ácido acético a 10% (Sigma), 1 × PBS 2 e 6 horas após a mudança de temperatura. As células mantidas a 33 ° C em paralelo também foram fixadas nos mesmos pontos de tempo. Após a permeabilização com 70% de etanol durante a noite a 4 ° C, as células foram reidratadas com 2 × SSC, 50% de formamida e sondadas com 30 ng de sonda deoxioligonucleotídeo antisense específico para U3 conjugada com Cy3 por 3 horas a 37 ° C em tampão de hibridização ( 10% de sulfato de dextrana, 2 mM de complexo vanadil-ribonucleosídeo, 0,02% de BSA livre de RNAse, 40 μg E. coli tRNA, 2 × SSC e 50% formamida). A sonda U3 humana (obtida da Operon Technologies) que foi usada é 5'GQTCTCTCCCTCQCACTCCCCAAQACGGAGAGAAGAACGAQCATCAATGGCQG 3 'onde Q indica resíduos T modificados com aminoalil incorporados para acoplamento Cy3. Cy3 foi obtido da Amersham Pharmacia Biotech e o acoplamento foi realizado seguindo as recomendações do fabricante. O oligo modificado foi purificado a partir do corante Cy3 não reativo usando um kit de remoção de nucleotídeos (Qiagen). As sondas acopladas foram executadas em géis de poliacrilamida não desnaturante de 8% e detectadas por iluminação UV para estimar a eficiência de acoplamento e recuperação após a purificação. A imunofluorescência indireta foi realizada conforme descrito em outro lugar (http://singerlab.aecom.yu.edu/protocols) usando uma diluição de 1: 100 de anticorpos cap anti-trimetil guanosina (TMG) (Bringmann et al., 1983) e um 1: Diluição 50 de anticorpos secundários anti-coelho conjugados com Cy2 (Jackson Immunoresearch Laboratories). As lamínulas foram montadas em lâminas com 90% de glicerol em 1 × PBS contendo 1 mg / ml p-fenileno diamina e 1μg / ml 4,6-diamino-2-fenilindol (DAPI).

Cepas de levedura e meios de comunicação

Todas as cepas de levedura foram cultivadas em meio de dextrose peptonada de extrato de levedura (YEPD) sob condições padrão (Adams et al., 1997). O genótipo relevante para a cepa de tipo selvagem, ACY192, é Esteirauma ura3-52, trp1- Δ63, leu21. Os seguintes mutantes sensíveis à temperatura também foram usados: ACY212, Esteirauma GSP1 :: HIS3 GSP2 :: HIS3 ura3-52 leu21, trp163 (transformado com um gsp1-1, LEU, AMP, CEN plasmídeo (pAC413) ou com um gsp1-2, LEU, AMP, CEN plasmídeo (pAC414)) (Wong et al., 1997) ACY109 Esteirauma prp20-1 trp1 leu21 ura3 (Amberg et al., 1993) e ACY61, Esteirauma rna1-1 leu21 ura3-52 his3(Corbett et al., 1995a).

Hibridização in situ de fluorescência de levedura e imunofluorescência

A análise de FISH e a imunofluorescência em levedura foram realizadas conforme descrito (Amberg et al., 1992, Wong et al., 1997), exceto que foram utilizadas sondas de DNA com rótulo Cy3. As sondas anti-sentido contra deoxioligonucleotideo levedura snoRNA U3 (5'ATTCAGTGGCTCTTTTGAAGAGTCAAAGAGTGACGATTCCTATAGAAATGA 3 '), snR10 snoRNA (5' CAGACGACAGAAAGACTGTTGCACCCAAGATCGATAAATTTGTTCTCCAGTCC 3 ') e poli (A) + mRNA (oligo d (T) 50) foram sintetizados por Operon Technologies, com uma única Rótulo Cy3 na extremidade 5 ′. Resumidamente, as cepas foram cultivadas em YEPD à temperatura ambiente e mudadas para 37 ° C por 3 horas. As células fixadas com formaldeído foram colhidas, esferoplastadas com 300 μg de Zymolyase 100T (US Biological), ressuspensas em solução P (sorbitol 1,2 M em tampão de fosfato de potássio 0,1 M, pH 6,5) e aplicadas a lâminas de microscópio com face de Teflon de 14 poços (CellPoint Scientific, Inc.) pré-revestido com 0,1% de polilisina. Após permeabilização com 0,5% de IGEPAL, a hibridização foi realizada usando 100-150 ng de sonda marcada com Cy3 durante a noite a 37 ° C. Em alguns experimentos, a imunofluorescência indireta também foi realizada conforme descrito anteriormente (Wong et al., 1997) usando uma diluição de 1: 1000 de anticorpos monoclonais anti-Nop1p (A66) (Aris e Blobel, 1988) e uma diluição de 1:50 de Texas -Anticorpos secundários anti-camundongo conjugados a vermelho (Jackson Immunoresearch Laboratories). As células foram coradas com 1 μg / ml 4,6-diamino-2-fenilindol (DAPI), secas ao ar e montadas em 1 mg p-fenilenodiamina / ml de glicerol a 90% em 1 × PBS.

Xenopus laevis microinjeção de oócitos e análise de RNA

A retenção nuclear e a localização nucleolar de U3 snoRNA ou U65 snoRNA microinjetados marcados com fluorescência foram ensaiadas como descrito anteriormente (Narayanan et al., 1999a Narayanan et al., 1999b Speckmann et al., 1999) em Xenopus oócitos nos quais o sistema Ran foi interrompido usando Ran T24N. Os RNAs para microinjeção foram transcritos in vitro com um marcador fluoresceína-12-UTP (para detecção por microscopia de fluorescência) e um marcador 32 P-GTP (para detecção por eletroforese em gel e autorradiografia). Ran mutante T24N recombinante foi expresso e purificado a partir de E. coli conforme descrito anteriormente (Lounsbury et al., 1996). U1sm - snRNA marcado com 32 P (e U3 snoRNA na Fig. 5C e D) foi co-injetado com os RNAs marcados com fluoresceína como controles para exportação nuclear de RNA (ou retenção). 40 μmoles de Ran T24N em 10 nl de tampão de microinjeção (10 mM de NaH2PO4, pH 7,2, KCl 70 mM, MgCl 1 mM2 e 10 mg / ml de dextrano azul) ou 10 nl de tampão de microinjeção sozinho foram injetados nos núcleos de oócitos de estágio V / VI. Os oócitos foram incubados a 18 ° C durante 1 hora antes de uma segunda injeção nuclear contendo 1 fmole de U3 ou U65 marcado com fluoresceína / 32 P-GTP. Para análise da localização intra-nuclear, os oócitos foram incubados a 18 ° C, e os núcleos foram dissecados quatro horas após a injeção do RNA. O conteúdo de cada núcleo dissecado foi transferido para uma lâmina de microscópio. As lâminas foram centrifugadas, fixadas, montadas e submetidas a microscopia de fluorescência conforme descrito (Narayanan et al., 1999a Narayanan et al., 1999b). Para a análise da distribuição nucleocitoplasmática, o RNA foi extraído das frações nucleares e citoplasmáticas de outros do conjunto de oócitos injetados, e os RNAs radiomarcados foram detectados por eletroforese em gel desnaturante a 8% e autorradiografia.

Os snoRNAs U3 e U65 microinjetados são retidos dentro do núcleo e localizados nos nucléolos de Xenopus oócitos após injeção de T24N Ran. (A, C) RanT24N recombinante em tampão de microinjeção (painéis inferiores) ou tampão de microinjeção sozinho (painéis superiores) foram injetados em conjuntos separados de oócitos. Uma hora depois, uma fmole de U3 ou U65 snoRNA fluorescente e marcada com 32 P foi injetada no mesmo conjunto de oócitos. As propagações nucleares foram feitas quatro horas após a injeção do RNA, e as lâminas foram analisadas por microscopia de fluorescência. Vários nucléolos individuais são mostrados em cada painel de contraste de interferência diferencial (DIC). Os sinais de fluorescência (RNA) mostram que os snoRNAs injetados são direcionados a uma sub-região centralmente localizada dos nucléolos em oócitos, que foram injetados com o T24N Ran (+ T24N). (B, D) Nuclear (N) e citoplasmático (C) as frações foram obtidas a partir do mesmo conjunto de células injetadas. O RNA foi extraído das frações N e C e submetido a PAGE desnaturante seguido por autorradiografia. A faixa do marcador (M) indica as amostras antes da injeção.

Os snoRNAs U3 e U65 microinjetados são retidos dentro do núcleo e localizados nos nucléolos de Xenopus oócitos após injeção de T24N Ran. (A, C) RanT24N recombinante em tampão de microinjeção (painéis inferiores) ou tampão de microinjeção sozinho (painéis superiores) foram injetados em conjuntos separados de oócitos. Uma hora depois, uma fmole de U3 ou U65 snoRNA fluorescente e marcada com 32 P foi injetada no mesmo conjunto de oócitos. As propagações nucleares foram feitas quatro horas após a injeção do RNA, e as lâminas foram analisadas por microscopia de fluorescência. Vários nucléolos individuais são mostrados em cada painel de contraste de interferência diferencial (DIC). Os sinais de fluorescência (RNA) mostram que os snoRNAs injetados são direcionados a uma sub-região centralmente localizada dos nucléolos em oócitos, que foram injetados com o T24N Ran (+ T24N). (B, D) Nuclear (N) e citoplasmático (C) as frações foram obtidas a partir do mesmo conjunto de células injetadas. O RNA foi extraído das frações N e C e submetido a PAGE desnaturante seguido por autorradiografia. A faixa do marcador (M) indica as amostras antes da injeção.

Microscopia

A microscopia foi realizada usando um microscópio de fluorescência invertido Zeiss Axiovert S 100 equipado com óptica de contraste de interferência diferencial (Thornwood, NY, EUA). As imagens foram adquiridas usando uma câmera de dispositivo de carga acoplada resfriada (Quantix-Photometrix, AZ, EUA) e o software IP Lab Spectrum (Signal Analytics, VA).