Em formação

Isolamento de grânulos intactos de mastócitos

Isolamento de grânulos intactos de mastócitos


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Como isolar grânulos intactos de mastócitos sem usar sacarose e percoll?


Poliaminas estão presentes em grânulos secretores de mastócitos e são importantes para a homeostase dos grânulos

Os grânulos secretores de mastócitos acomodam um grande número de componentes, muitos dos quais interagem com o proteoglicano de serglicina (PG) altamente sulfatado presente nos grânulos. As poliaminas (putrescina, espermidina e espermina) são absolutamente necessárias para a sobrevivência da grande maioria das células vivas. Dada a capacidade relatada de poliaminas para interagir com PGs, investigamos a possibilidade de que poliaminas podem ser componentes de grânulos secretores de mastócitos.

Metodologia / Principais conclusões

A espermidina foi liberada por mastócitos derivados da medula óssea (BMMCs) de camundongo após desgranulação induzida por IgE / anti-IgE ou ionóforo de cálcio A23187. Além disso, tanto a espermidina quanto a espermina foram detectadas em grânulos de mastócitos de camundongo isolados. Além disso, a depleção de poliaminas por cultura de BMMCs com α-difluorometilornitina (DFMO) causou ultraestrutura de grânulos de secreção aberrante, armazenamento de histamina prejudicado, níveis reduzidos de serotonina e conteúdo aumentado de β-hexosaminidase. Uma abordagem proteômica revelou que a depleção de poliamina induzida por DFMO causou uma alteração nos níveis de uma série de proteínas, muitas das quais estão conectadas com a exocitose regulada ou com o sistema endocítico.

Conclusões / Significância

Em conjunto, nossos resultados mostram evidências de que as poliaminas estão presentes nos grânulos secretores de mastócitos e, além disso, indicam um papel essencial desses policatiões durante a biogênese e homeostase dessas organelas.

Citação: García-Faroldi G, Rodríguez CE, Urdiales JL, Pérez-Pomares JM, Dávila JC, Pejler G, et al. (2010) As poliaminas estão presentes em grânulos secretores de mastócitos e são importantes para a homeostase dos grânulos. PLoS ONE 5 (11): e15071. https://doi.org/10.1371/journal.pone.0015071

Editor: David Holowka, Cornell University, Estados Unidos da América

Recebido: 6 de setembro de 2010 Aceitaram: 19 de outubro de 2010 Publicados: 30 de novembro de 2010

Direito autoral: © 2010 García-Faroldi et al. Este é um artigo de acesso aberto distribuído sob os termos da Creative Commons Attribution License, que permite o uso irrestrito, distribuição e reprodução em qualquer meio, desde que o autor original e a fonte sejam creditados.

Financiamento: Este trabalho foi apoiado pelas bolsas SAF2008-02522 (Ministerio de Ciencia e Innovación, Espanha), P07-CVI-02999 e grupo BIO-267 (Junta de Andalucía, Espanha) e fundos fornecidos pela Fundación Ramón Areces (Espanha). Também contou com a ajuda da Ação BM0806 de Cooperação Europeia em Ciência e Tecnologia (COST), apoiada pelo Programa-Quadro de Pesquisa e Desenvolvimento Tecnológico (IDT) da União Europeia (UE). O CIBER-ER é uma iniciativa do Instituto de Salud Carlos III (Espanha). Os financiadores não tiveram nenhum papel no desenho do estudo, coleta e análise de dados, decisão de publicar ou preparação do manuscrito.

Interesses competitivos: Os autores declararam que não existem interesses conflitantes.


Introdução

Os mastócitos são células importantes do sistema imunológico e são da linhagem hematopoiética. Os mastócitos são originados de células progenitoras pluripotentes da medula óssea e amadurecem sob a influência do ligante c-kit e do fator de células-tronco na presença de outros fatores de crescimento distintos fornecidos pelo microambiente do tecido onde estão destinados a residir. Em condições normais, os mastócitos maduros não circulam na corrente sanguínea. No entanto, os progenitores de mastócitos migram para os tecidos e se diferenciam em mastócitos sob a influência do fator de células-tronco e de várias citocinas. Os mastócitos estão presentes em todo o corpo e desempenham papéis importantes na manutenção de muitas funções fisiológicas, bem como na fisiopatologia de doenças. Consequentemente, esta revisão enfoca o papel dos mastócitos em uma ampla gama de funções fisiológicas e na patogênese de uma variedade de estados de doença.

Localização dos mastócitos

Os mastócitos são encontrados em tecidos mucosos e epiteliais em todo o corpo. Em roedores, os mastócitos também residem nas cavidades peritoneal e torácica. Os mastócitos são encontrados em todos os tecidos vascularizados, exceto no sistema nervoso central e na retina (1). Os mastócitos estão localizados no ponto de junção do hospedeiro e do ambiente externo nos locais de entrada do antígeno (trato gastrointestinal, pele, epitélio respiratório) (1 & # x020134). Os mastócitos estão localizados em áreas abaixo do epitélio no tecido conjuntivo ao redor das células sanguíneas, músculos lisos, mucosas e folículos pilosos.

O citoplasma do mastócito contém 50 & # x02013200 grânulos grandes que armazenam mediadores inflamatórios, incluindo histamina, heparina, uma variedade de citocinas, sulfato de condroitina e proteases neutras (1). Para que os mastócitos migrem para seus locais-alvo, são necessários os efeitos coordenados de integrinas, moléculas de adesão, quimiocinas, citocinas e fatores de crescimento (5). Os progenitores de mastócitos são encontrados em grande número no intestino delgado. O CXCR2 expresso em progenitores de mastócitos direciona sua migração para o intestino delgado. A ligação das integrinas & # x003b14 & # x003b27 (expressa nos mastócitos) à molécula de adesão VCAM-1 no endotélio inicia o trânsito dos precursores dos mastócitos para fora da circulação (5).

Os pulmões não possuem muitos progenitores de mastócitos em um estado fisiológico normal. Após a inflamação induzida por antígeno do endotélio respiratório, os progenitores de mastócitos são recrutados envolvendo integrinas & # x003b14 & # x003b27, VCAM-1 e CXCR2. Além disso, o CCR-2 e o CCL-2 estão envolvidos no recrutamento de progenitores de mastócitos para o endotélio respiratório. Quando os mastócitos maduros são ativados e desgranulados, mais progenitores de mastócitos são recrutados para o local da inflamação (5).

Existem dois fenótipos de mastócitos humanos: mastócitos da mucosa que produzem apenas triptase e mastócitos do tecido conjuntivo que produzem quimase, triptase e carboxipeptidases (6, 7). A ativação de mastócitos e a liberação de mediadores têm diferentes efeitos em vários tecidos e órgãos. Os locais mais comuns no corpo expostos a antígenos são a mucosa do trato respiratório (no ar), o trato gastrointestinal (de origem alimentar), o sangue (feridas, absorção do trato respiratório / trato gastrointestinal) e tecidos conjuntivos (8).

Quando o trato gastrointestinal é exposto a um antígeno, sua resposta é aumentar a secreção de fluido, aumentar a contração do músculo liso e aumentar o peristaltismo. Proteínas derivadas de diferentes plantas e animais podem atuar como antígenos e ativar o sistema imunológico em indivíduos vulneráveis ​​(8). O antígeno (peptídeo) permeia através da camada epitelial da mucosa do intestino e se liga à IgE nos mastócitos da mucosa. Esses peptídeos são apresentados às células Th2 e, se houver um anticorpo IgE contra o peptídeo presente, ele causará a ativação do mastócito, resultando em uma resposta imune. Isso faz com que os mastócitos se degranulem e liberem uma variedade de mediadores inflamatórios. Esses mediadores aumentam a permeabilidade vascular, causando edema no epitélio intestinal e contração da musculatura lisa, que levam ao vômito e diarreia. Esse tipo de reação pode ocorrer em resposta a peptídeos encontrados em certos medicamentos. Os alérgenos alimentares também podem causar reações na pele. A absorção do trato gastrointestinal pode introduzir antígenos no sangue, que são transportados por todo o corpo, onde se ligam à IgE nos mastócitos do tecido conjuntivo nas camadas profundas da pele. Isso resulta em reação urticariforme e angioedema (8).

No trato respiratório, a resposta imune à ativação dos mastócitos resulta em constrição das vias aéreas, aumento da produção de muco e tosse (1). A introdução mais comum de antígenos no trato respiratório é por inalação. Os mastócitos da mucosa no epitélio nasal são ativados por antígenos que se difundem pela mucosa após serem inalados. No trato respiratório, a degranulação dos mastócitos aumenta a permeabilidade vascular e o edema local, que podem obstruir as vias aéreas nasais e levar à congestão (9, 10). Há aumento da produção de muco e seu acúmulo pode bloquear os seios da face e resultar em infecção bacteriana. Os mastócitos também desempenham um papel fundamental na fisiopatologia da asma alérgica. Isso é causado por uma resposta inflamatória nas vias aéreas, que resulta de antígenos inalados que entram no trato respiratório inferior e causam degranulação de mastócitos e inflamação local. Esses eventos levam ao aumento da permeabilidade vascular, acúmulo de líquido e edema, que pode obstruir as vias aéreas. A constrição brônquica pode ocorrer devido à contração do músculo liso, que pode levar à obstrução das vias aéreas que é observada na asma. O ar é, portanto, aprisionado e a capacidade pulmonar total é aumentada, enquanto o volume expiratório forçado em 1 & # x02009s (VEF1) e a capacidade vital forçada (CVF) são diminuídos (8). Nos vasos sanguíneos, o aumento da permeabilidade vascular leva ao edema e inflamação local, que resulta no transporte do antígeno para os linfonodos (11).

Na pele, os antígenos, via IgE, ativam os mastócitos nas camadas profundas do tecido conjuntivo. Os mastócitos liberam histamina, bem como outras moléculas vasoativas, que causam urticária (urticária). Se o antígeno ativar os mastócitos em tecidos mais profundos, isso pode levar ao angioedema. Se a resposta for prolongada, pode ocorrer dermatite atópica ou eczema. O eczema é visto clinicamente como uma erupção cutânea com coceira crônica com lesões elevadas e secreção de fluido. O eczema é mais comumente visto na infância, enquanto a rinite alérgica e a asma são vistas ao longo da vida (8).

Mecanismo de Ativação

Os mastócitos são conhecidos por seu principal mecanismo de ação: reações alérgicas mediadas por IgE por meio do receptor Fc & # x003f5RI. Os anticorpos IgE são produzidos por células B maduras em resposta às células CD4 + Th2. Células B maduras Na & # x000efve produzem anticorpos IgM e IgD. Assim que forem ativadas por um antígeno, as células B irão proliferar. Se essas células B interagirem com citocinas, como a IL-4 (que é modulada por células CD4 + Th2), a classe de anticorpos muda de IgM para IgE (12). A IgE é encontrada principalmente ligada aos receptores Fc & # x003f5RI nos mastócitos, e muito pouca IgE é encontrada como um anticorpo solúvel em circulação. Quando um antígeno entra em contato com o mastócito, ele reticula duas ou mais moléculas Fc & # x003f5RI e ativa a liberação de grânulos do mastócito (13). A IgE é encontrada no tecido conjuntivo sob as camadas epiteliais da pele, no trato respiratório e também no trato gastrointestinal (1). Além de Fc & # x003f5RI, os mastócitos também expressam receptores Fc para IgA e IgG, receptores para adenosina, C3a, quimiocinas, citocinas e padrões moleculares associados a patógenos (PAMPs), bem como receptores toll-like (TLRs), todos dos quais estão envolvidos na ativação dos mastócitos e na resposta imune.

A via fisiológica mais comum para a ativação dos mastócitos é via reticulação antígeno / IgE / Fc & # x003f5RI (14). Fc & # x003f5RI consiste em uma cadeia & # x003b1 que se liga a IgE, uma cadeia & # x003b2, que atravessa a membrana, e cadeias & # x003b3, que são um homodímero ligado por dissulfeto. Fc & # x003f5RI interage com LYN tirosina quinase, que fosforila a tirosina em seus motivos de ativação de bases de tirosina imunorreceptor (ITAMs) nas cadeias B e & # x003b3 de Fc & # x003f5RI (15). Lyn ativa tirosina quinases Syk, que fosforila proteínas de sinalização, como LAT1 e LAT2 (ligantes para ativação de células T) (16). PLC fosforilado & # x003b3 hidrolisa fosfatidilinositol-4,5-bifosfato para produzir inositol-1,4,5-trifosfato (IP3) e diacilglicerol (DAG). IP3 e DAG são segundos mensageiros e IP3 causa mobilização de cálcio do retículo endoplasmático (17). A liberação de cálcio é ativada e faz com que NF & # x003baB se transloque para o núcleo da célula, o que resulta na transcrição de citocinas, como IL-6, TNF & # x003b1 e IL-13. Zeb2 está envolvido na regulação da degranulação após estimulação via Fc & # x003f5RI (18). A ativação de Fc & # x003f5RI ativa Fyn (Src quinase). Fyn regula a desgranulação dos mastócitos, que é complementar à via de sinalização de Lyn. Fyn ativa PI3K, que ativa Akt e produz PIP3 (15). Isso ativa o mTOR, que está envolvido na quimiotaxia dos mastócitos e na produção de citocinas (14). Existem também receptores para IgG chamados Fc & # x003b3R. O homodímero de cadeia y é o mesmo em Fc & # x003b3RI e em Fc & # x003f5RI, de modo que o sinal enviado de Fc & # x003b3R pode fazer a interferência cruzada com Fc & # x003f5RI (14). A exposição repetida e controlada de mastócitos ao antígeno pode dessensibilizar a sensibilidade do paciente. Embora os mecanismos não sejam claramente compreendidos, acredita-se que a degranulação lenta e persistente dos mastócitos seja um dos mecanismos. O protocolo de dessensibilização é usado em pacientes que são alérgicos a certos medicamentos (por exemplo, penicilina), mas precisam de tratamento para uma infecção bacteriana com risco de vida que só pode ser tratada com este medicamento.

A dessensibilização dos mastócitos pode ocorrer devido à exposição a doses crescentes de antígeno. Esta técnica pode ser usada se o paciente for alérgico a um medicamento necessário e na prevenção de reações anafiláticas a alimentos. Ao dessensibilizar os receptores, isso pode diminuir o número de moléculas Fc & # x003f5RI disponíveis na superfície dos mastócitos (19).


Isolamento e caracterização de grânulos corticais associados à membrana plasmática de ovos de ouriço-do-mar

Grânulos corticais, que são organelas secretoras especializadas encontradas em óvulos de muitos organismos, foram isolados dos ovos dos ouriços-do-mar Arbacia punctulata e Strongylocentrtus pupuratus por um procedimento simples e rápido. O exame por microscopia eletrônica de grânulos corticais preparados por este procedimento revela que eles estão firmemente fixados a grandes segmentos da membrana plasmática e sua camada vitelina associada. Evidências adicionais de que os grânulos corticais estavam associados a essas camadas de superfície celular foram obtidas por meio de técnicas de marcação (125) I. As preparações de grânulos corticais foram encontradas ricas em proteoesterase, que foi purificada 32 vezes sobre o que foi detectado em um homogenato bruto. Da mesma forma, a radioatividade específica de uma glicoproteína de superfície marcada com (125) I foi aumentada em 40 vezes. Esses fatos, juntamente com as observações do microscópio eletrônico, indicam que o procedimento de isolamento produz uma preparação na qual tanto os grânulos corticais quanto a membrana plasmática-camada vitelina são purificados na mesma extensão. A eletroforese em gel da preparação de grânulos corticais associados à membrana revela a presença de pelo menos oito polipeptídeos. O polipeptídeo principal, que é uma glicotoproteína de peso molecular aparente de 100.000, contém a maior parte da radioatividade introduzida pela marcação com (125) I dos ovos intactos. A lise dos grânulos corticais é observada em condições hipotônicas, ou em condições isotônicas se o íon Ca (2+) estiver presente. Quando a lise está sob condições isotônicas é induzida pela adição do íon Ca (2+), o conteúdo denso de elétrons dos grânulos permanece insolúvel. Em contraste, a lise hipotônica resulta na liberação do conteúdo do grânulo em uma forma solúvel. No entanto, em ambos os casos, a glicoproteína marcada com (125) I permanece insolúvel, presumivelmente porque é um componente da membrana plasmática ou da camada vitelina. Todas essas descobertas indicam que, usando esta preparação purificada, deve ser possível realizar estudos in vitro para definir melhor alguns dos eventos iniciais relacionados à superfície observados in vivo após a fertilização.


Resumo

Objetivo- Estudos recentes destacaram a importância patogenética da inflamação crônica em doenças cardiovasculares, como insuficiência cardíaca congestiva e aterosclerose. Os mastócitos liberam uma ampla variedade de mediadores imunológicos que podem iniciar respostas inflamatórias, enquanto as células endoteliais (CEs) desempenham um papel proeminente na patogênese de doenças cardiovasculares pela secreção de citocinas. O objetivo deste estudo foi esclarecer o papel dos mastócitos como ativadores de CEs.

Métodos e resultados - ECs colhidos de veias do cordão umbilical humano foram estimulados com grânulos de mastócitos (MCGs) preparados a partir de mastócitos leucêmicos humanos sonicados. Os sobrenadantes e o RNA total das células foram coletados. Os níveis de interleucina (IL) -1β, fator de necrose tumoral-α e fator estimulador de colônias de granulócitos permaneceram inalterados por até 24 horas. Em contraste, os níveis de proteína-1 quimioatraente de monócitos (MCP-1) e IL-8 aumentaram significativamente em 6 horas. A análise de Northern blot revelou um aumento na expressão de mRNA de MCP-1 e IL-8 em ECs tratados com MCG. A indução dessas quimiocinas foi atenuada pelo anticorpo neutralizante da antitriptase. Além disso, MCP-1 e IL-8 foram induzidas em ECs por incubação com triptase de mastócitos humanos, mas não com quimase.

Conclusões- Esses resultados indicam que a produção de MCP-1 e IL-8 em ECs foi induzida por MCG e amplificada pela triptase.

O papel dos mastócitos na patogênese das doenças cardiovasculares foi recentemente destacado. No entanto, o mecanismo permanece obscuro. Este estudo demonstra que a desgranulação dos mastócitos causa a produção de quimiocinas nas células endoteliais. Essas observações sugerem a ligação entre os mastócitos e a aterosclerose por meio da produção endotelial de quimiocina.

Estudos recentes mostraram que a infecção crônica, a inflamação e os fatores imunológicos estão intimamente associados ao desenvolvimento de certos distúrbios cardiovasculares. A inflamação crônica aumenta o número de macrófagos e linfócitos T nas lesões ateroscleróticas. 1 A progressão das lesões também pode estar associada ao aumento das concentrações plasmáticas de proteína C reativa, um marcador de inflamação considerado um sinal precoce de aterosclerose. 2 A resposta imune à infecção viral pode ser a principal fonte de cardiomiopatia dilatada. O equilíbrio entre as citocinas inflamatórias e antiinflamatórias desempenha um papel fundamental no desenvolvimento da insuficiência cardíaca e das lesões ateroscleróticas. Proteínas quimioatrativas (quimiocinas) são encontradas em ateromas humanos, 3,4 e camundongos sem quimiocinas ou seus receptores são menos propensos à aterosclerose. 5–8 Além disso, mostramos que a expressão da proteína-1 quimioatraente de monócitos (MCP-1) está aumentada no coração com sobrecarga de pressão e insuficiência cardíaca. 9

Os mastócitos são células efetoras residentes essenciais na elicitação da resposta imune, encontradas em quase todos os principais órgãos, perto dos vasos sanguíneos em particular. 10 Estudos recentes sugeriram que os mastócitos desempenham um papel na progressão da insuficiência cardíaca, aterosclerose e ruptura do ateroma. 11-13

Os mastócitos são geralmente perivasculares e podem regular a função das células endoteliais (CE). CEs são a principal fonte de várias moléculas bioativas, incluindo citocinas e quimiocinas. Este estudo testou a hipótese de que a degranulação de mastócitos por determinados estímulos pode regular a produção de citocinas a partir de CEs e participar do desenvolvimento de insuficiência cardíaca e de lesões ateroscleróticas.

Métodos

Bioquímicos e outros materiais

Meio 199 (M-199), sal de sódio de heparina de grau I-A da mucosa intestinal porcina, solução de triptase humana, N-benzoil-D,eu-arginina-p-nitroanilida (BAPNA), e N-succinil-eu-Ala-eu-Ala-eu-Pró-eu-Phe-p-nitroanilida (SAAPP) foram adquiridos a Sigma Chemical Co (St Louis, Mo). A quimase humana recombinante foi obtida de Teijin Ltd (Osaka, Japão) e SF-8257 foi de Suntory Biomedical Research Ltd (Osaka, Japão). Soro fetal de vitela e tripsina / EDTA foram obtidos de Life Technologies Inc (Grand Island, NY). Kits de ensaio de imunoabsorção enzimática específicos para interleucina (IL) -1β, fator de necrose tumoral-α, fator estimulador de colônia de granulócitos e fator estimulador de colônia de macrófagos de granulócitos foram adquiridos da Otsuka Pharmaceutical Co (Tokushima, Japão), e kits para MCP-1 e IL-8 eram da Toray Industries Inc (Tóquio, Japão). O anticorpo neutralizante contra a triptase foi purificado conforme descrito anteriormente. 14,15

Cultura de células

Os CEs foram isolados de veias umbilicais humanas conforme descrito anteriormente 16 e cultivados em M-199 suplementado com soro fetal de bezerro inativado por calor a 20%, heparina 90 μg / mL e antibióticos (penicilina, estreptomicina 50 U / mL, 50 μg / mL e anfotericina B, 125 ng / mL). As células nas passagens 3 ou 4 foram semeadas em placas de cultura revestidas com 0,5% de gelatina e incubadas a 37 ° C em uma atmosfera umidificada de 5% de CO2/ 95% ar. Após a monocamada ter se tornado confluente, o meio de cultura foi alterado para M-199 com 5% de soro fetal de bezerro inativado pelo calor, e as células foram incubadas durante a noite e grânulos de mastócitos (MCGs) foram adicionados. Os CEs foram identificados por sua aparência típica de “paralelepípedo” e pela coloração do antígeno do fator VIII por imunofluorescência. Linhagem de mastócitos humanos 1 (HMC-1) (um gentil presente de JH Butterfield, Mayo Clinic, Rochester, Minn) foram cultivadas em meio de Dulbecco modificado de Iscove (Life Technologies, Grand Island, NY) com 10% de soro fetal de bezerro inativado pelo calor , 4 mmol / L l-glutamina e antibióticos (penicilina, 50 U / mL estreptomicina, 50 μg / mL e anfotericina B, 125 ng / mL) em uma atmosfera umidificada de 5% de CO2/ 95% ar. O número de células foi ajustado para 5 × 10 6 células / mL duas vezes por semana adicionando meio fresco.

Preparação de MCGs

Os MCGs foram preparados conforme descrito anteriormente. 17 Resumidamente, em condições estéreis, os MCGs foram obtidos por sonicação de banho em gelo por 5 segundos a partir de HMC-1 (5 × 10 6 células / mL) suspenso em meio de cultura. A sonicação foi então microcentrifugada (5 minutos) a 4 ° C, e os sobrenadantes livres de resíduos foram divididos em alíquotas e armazenados a -80 ° C. Esta solução foi usada como MCG e então adicionada às células endoteliais da veia umbilical humana (ECs) incubadas em uma placa de 24 poços. Para confirmar que existem atividades enzimáticas no procedimento de preparação de MCG, medimos a atividade de triptase e quimase conforme descrito anteriormente. 18 A atividade da triptase foi determinada por sua capacidade de clivar um substrato sintético N-benzoil-D,eu-arginina-p-nitroanilida (BAPNA) 2 mmol / L em Tris-HCl 0,1 mol / L (pH 8,0) e glicerol 1mol / L a 410 nm. A atividade de quimase foi determinada espectrofotometricamente (410 nm) pela taxa de hidrólise de N-succinil-eu-Ala-eu-Ala-eu-Pró-eu-Phe-p-nitroanilida (SAAPP) 0,7 mmol / L em NaCl 1,5mol / L e Tris 0,3mol / L (pH 8,0). A atividade da protease foi expressa em miliunidades por mililitro (mU / mL), em que 1 U de atividade enzimática foi definida como a quantidade que degradava 1 μmol de substrato por minuto a 25 ° C. A atividade da triptase das preparações de MCG utilizadas no presente estudo foi de 12,62 mU / mL e a atividade da quimase foi de 3,81 mU / mL.

Protocolos Experimentais

Medição da produção de citocinas por células endoteliais

CEs, em uma densidade de 500 células / mm 2, foram incubados em meio completo e deixados aderir em uma placa de 24 poços por 48 horas. O meio foi então mudado para M-199 com 5% de soro fetal de vitela inativado pelo calor por um período de 24 horas. MCG foram então adicionados por até 24 horas. As concentrações de IL-1β, fator de necrose tumoral-α, IL-8, MCP-1, fator estimulador de colônias de granulócitos e fator estimulador de colônias de granulócitos macrófagos no sobrenadante foram medidas por ensaio imunoenzimático e comparadas com aquelas de células de controle expostas à solução HMC-1 pelo mesmo período de tempo, no entanto, sem sonicação anterior.

Isolamento de RNA e hibridização Northern Blot

O RNA total foi isolado pelo procedimento de tiocianato de guanidínio-fenol-clorofórmio-álcool isoamílico de ECs incubados com MCG por 0, 1, 6 ou 24 horas, e a análise de Northern blot foi realizada. 19 Quantidades iguais de RNA foram submetidas a eletroforese em gel de agarose / formaldeído a 1,2% e transferidas para uma membrana de náilon (Hybond-N + Amersham Corp, Bunckinghamshire, Inglaterra) por procedimentos padrão. 20 Os blots foram hibridizados sequencialmente com sondas de cDNA marcadas com alfa-32 P-dCTP para MCP-1 e IL-8 humanas. Após a hibridização durante a noite, as membranas foram lavadas com 2 × SSPE / SDS a 0,1% à temperatura ambiente, 1 × SSPE / SDS a 0,1% a 65 ° C e 0,1 × SSPE / SDS a 0,1% a 65 ° C. Os blots foram analisados ​​com um analisador de bioimagem FUJIX BAS 2000 (Fujix, Tóquio, Japão) e normalizados para o nível de rRNA 18S correspondente.

Papéis da triptase e quimase na expressão gênica induzida por MCG e na produção de MCP-1 e IL-8

Em uma série de experimentos, o anticorpo neutralizante de antitriptase, o controle IgG não imunizado ou o inibidor seletivo de quimase SF-8257 foi adicionado ao meio de cultura 1 hora antes da estimulação MCG para estudar o papel da triptase e da quimase na produção induzida por MCG de MCP-1 e IL-8. O anticorpo antitriptase foi usado em concentrações de 0,001 a 10 μg / mL, IgG de controle em 10 μg / mL e SF8257 em concentrações de 10 −7 a 10 −5 mol. SF8257 foi confirmado para ser eficaz em uma concentração de 10-5 mol.

Efeitos da triptase e quimase na produção de MCP-1 e IL-8

CEs, em uma densidade de 500 células / mm 2, foram incubados em meio completo e deixados aderir em uma placa de 24 poços por 48 horas. O meio foi então alterado para M-199 com 5% de soro fetal de vitela inativado pelo calor durante 24 horas. Triptase em concentrações de 0,3 a 3 μg / mL ou quimase em concentrações de 0,3 a 3 μg / mL foi então adicionada e as células foram cultivadas por até 24 horas.

Análise estatística

Os valores são apresentados como média ± SEM. Os resultados foram analisados ​​por Student desemparelhado t teste ou por análise de variância. P& lt0,05 foi considerado significativo.

Resultados

Liberação de citocina induzida por MCG

A Figura 1 mostra os níveis médios de citocinas medidos por ensaio de imunoabsorção enzimática em 3 experiências separadas. Os níveis de IL-1β, fator de necrose tumoral-α, fator estimulador de colônia de granulócitos e fator estimulador de colônia de granulócitos macrófagos não foram alterados pelo MCG. Em contraste, os níveis de MCP-1 e IL-8 aumentaram significativamente com a adição de MCG quando comparados com as culturas de controle. Os níveis de MCP-1 e IL-8 de ECs estimulados por MCG por 24 horas foram, respectivamente, 1,6 ± 0,1 vezes (P& lt0,05) e 16,4 ± 0,3 vezes (P& lt0.05) maior do que as das células mantidas estáticas por 24 horas. O aumento da produção de MCP-1 e IL-8 em ECs por MCG foi aparente em 6 horas (Figura 2).

Figura 1. Efeito de MCGs na produção de citocinas por ECs. ECs vasculares umbilicais humanos (HUVECs) foram cultivados em meio 199 na presença ou ausência de MCGs por 24 horas e a concentração de cada citocina nos sobrenadantes foi medida. Os valores são média ± SEM (n = 3). *P& lt0,05 vs controles.

Figura 2. Efeito dependente do tempo de MCGs na produção de MCP-1 e IL-8. As HUVECs foram cultivadas em meio completo 199 na presença ou ausência de MCG por 0, 1, 6 e 24 horas, e a concentração de MCP-1 ou IL-8 nos sobrenadantes foi medida. Os valores são média ± SEM (n = 3). *P& lt0,05 vs controles.

Efeitos do MCG na expressão gênica de MCP-1 e IL-8

A Figura 3 é um Northern blot representativo que mostra o curso do tempo dos níveis de mRNA de MCP-1 e IL-8. O nível de mRNA de MCP-1 aumentou em 1 hora, atingiu o pico em 6 horas e permaneceu significativamente aumentado em 24 horas. A análise densitométrica do nível de mRNA de MCP-1 normalizado para o rRNA de 18S mostrou um aumento de 2,2 ± 0,3 vezes em ECs estimulados por MCG em 6 horas em comparação com controles estáticos. O nível de mRNA de IL-8 também aumentou em 1 hora, atingiu o pico em 6 horas e, em seguida, retornou à linha de base. A análise densitométrica do nível de mRNA de IL-8 normalizado para o rRNA 18S mostrou um aumento de 2,4 ± 0,4 vezes em ECs estimulados por MCG expostos a MCG por 6 horas em comparação com controles estáticos. Os níveis de mRNA de MCP-1 e IL-8 dos controles não estimulados por MCG não mostraram nenhuma mudança significativa em 6 horas (Figura I, disponível online em http://atvb.ahajournals.org).

Figura 3. Efeito dependente do tempo de MCGs na expressão gênica de MCP-1 e IL-8. RNAs totais foram isolados de ECs incubados com MCGs por 0, 1, 6 ou 24 horas, e a análise de Northern blot foi realizada. As manchas foram hibridizadas sequencialmente com sondas de cDNA para MCP-1 e IL-8 humanas. Bandas de rRNA 18S correspondentes são mostradas como controles internos. Os valores são média ± SEM (n = 3). *P& lt0.05 vs controles estáticos.

Papéis da triptase e quimase na expressão gênica induzida por MCG e na produção de MCP-1 e IL-8

Como os mastócitos contêm uma variedade de mediadores, incluindo proteases, proteoglicanos e histamina, que poderiam estimular CEs a produzir quimiocinas, foi feita uma tentativa de identificar o fator que causou a produção de MCP-1 e IL-8. O tratamento de ECs com anticorpo policlonal contra triptase a 1 μg / mL inibiu a produção induzida por MCG de MCP-1 e IL-8 (Figura 4A). A análise de Northern blot mostrou que a inativação da triptase pelo anticorpo antitriptase, 1 μg / mL, inibiu a expressão do gene induzida por MCG de MCP-1 × 48 ± 16% e de IL-8 × 74 ± 19% (P& lt0.05 versus controles não tratados Figura 4B Figura II, disponível online em http://atvb.ahajournals.org). As mesmas concentrações de IgG policlonal não imune não alteraram a expressão gênica induzida por MCG nem a produção de proteínas de MCP-1 e IL-8 por MCG. Além disso, a inibição seletiva de quimase por SF-8257, 10-5 mol não diminuiu a produção induzida por MCG de MCP-1 e IL-8 (Figura 4C). Esses resultados sugerem que a triptase, mas não a quimase, desempenha um papel essencial na expressão gênica induzida por MCG de MCP-1 e IL-8.

Figura 4. Papéis da triptase e quimase na expressão gênica induzida por MCG e na produção de MCP-1 e IL-8. ECs foram pré-tratados com anticorpo neutralizante de triptase (0,001 a 10 μg / mL) (A) e SF-8257 (10 −7 a 10 −5 mol / L) (C), um inibidor de quimase, cada um por 1 hora antes da exposição de ECs a MCGs por 24 horas na análise dos níveis de proteína e por 6 horas no exame de expressões gênicas (B). Os valores são média ± SEM (n = 3). *P& lt0,05 vs controles. Bandas de rRNA 18S correspondentes são mostradas como controles internos.

Efeitos da triptase e quimase na produção de MCP-1 e IL-8

A triptase aumentou significativamente as produções de MCP-1 e IL-8 em CEs dentro de 6 horas de exposição (Figura 5A). Houve liberações dose-dependentes de MCP-1 e IL-8 de ECs em uma faixa de concentrações de triptase. Em contraste, a quimase não modificou a indução de MCP-1 e IL-8 (Figura 5B).

Figura 5. Efeito dependente do tempo e da dose de proteases na produção de MCP-1 e IL-8. Os CEs foram incubados em meio completo, com adesão por 48 horas e, em seguida, o meio foi trocado para o meio 199 com 5% de soro fetal de vitela inativado pelo calor por um período de 24 horas. Triptase em concentrações de 0,3 a 3 μg / mL ou quimase em concentrações de 0,3 a 3 μg / mL foi então adicionada e as células foram cultivadas por até 24 horas. Os valores são média ± SEM (n = 3). *P& lt0,05 vs controles.

Discussão

Este estudo indica que os MCGs induzem a produção por ECs humanos de MCP-1, um potente quimioatraente para monócitos, e de IL-8, um potente quimioatraente para neutrófilos, linfócitos T e eosinófilos. Esses efeitos foram mediados pela triptase de mastócitos humanos. O papel dos mastócitos na patogênese de doenças cardiovasculares, em particular da insuficiência cardíaca e aterosclerose, foi recentemente destacado. O número de mastócitos está aumentado no coração humano 11 insuficiente e no miocárdio de ratos recentemente infartados, 21 juntamente com um aumento em seus mediadores, como triptase e histamina. Mostramos anteriormente que os MCGs causam apoptose de cardiomiócitos e proliferação de fibroblastos cardíacos in vitro. 12 Além disso, nas artérias coronárias relacionadas ao infarto, o número de mastócitos degranulados na adventícia que protege as placas rompidas é aumentado. 13 Essas observações sugerem que os mastócitos e a triptase de mastócitos são ativados em corações deficientes e em lesões ateroscleróticas.

As quimiocinas atuam principalmente nos neutrófilos, monócitos, linfócitos e eosinófilos e desempenham um papel fundamental no sistema imunológico. 22–26 The study of chemokines has recently expanded to fields well beyond immunology, and it has become evident that they play key roles in cardiovascular diseases. 27,28 MCP-1, a chemotactic factor for monocytes and one of the C-C chemokines, is believed to be among the important molecules involved in atherogenesis 5 and heart failure. 9 We have previously reported that plasma levels of MCP-1 are also increased in patients with acute myocardial infarction 29 and have shown that antibody against MCP-1 reduces myocardial infarct size in a rat ischemia/reperfusion model. 30 These data sugerir that MCP-1, as an inflammatory mediator, plays a pivotal role in cardiac inflammatory responses in acute myocardial infarction. IL-8, a chemotactic factor for neutrophils and T lymphocytes, which belongs to the C-X-C chemokine family, may also play important roles in atherogenesis 31 and myocardial ischemia/reperfusion injury. 32

Several studies have reported an interaction between ECs and mast cells. ECs regulate the survival and development of mast cells, 33 and mast cell tryptase stimulates the production of IL-8 and the expression of IL-1β gene of ECs. 34 No longer regarded simply as a passive barrier separating the blood and surrounding tissue, ECs are now recognized as key players in the process of inflammation by producing various biomolecules, including cytokines and chemokines. Mast cells are localized at the adventitia in atherosclerotic coronary arteries. Adventitial inflammation is recognized as an important promoting factor of atherogenesis and the progression of arteriosclerosis. 35 Pro-inflammatory effects of adventitial mast cells on ECs seen in this study suggest that the mast cells can play a role in atherosclerosis by stimulating ECs as effector cells. Moreover, mast cell tryptase released from adventitia may influence the function of remote intimal ECs via vasa vasorum circulation. Our study is the first to show that the degranulation of mast cells causes the production of MCP-1 in ECs. This observation may explain the link between mast cells and the development of atherosclerosis and heart failure via the production of chemokine by ECs.

MCGs contain a wide variety of inflammatory mediators, the release of which depends on the stimulus. These mediators include histamine, cytokines, and proteases, which have various effects on neighboring cells. 36 Tryptase, chymase, cathepsin G, and carboxypeptidase are the major proteases contained in MCGs. 37 Tryptase plays a role as is a growth factor for a number of cell types, including fibroblasts, epithelial cells, and smooth muscle cells. 38 It may also be implicated in angiogenesis, because it induces tubular formation of ECs. 39

Chymase is closely associated with cardiovascular disorders. It is activated in pressure-overloaded hearts, is able to convert angiotensin I to angiotensin II independently of the angiotensin-converting enzyme, and plays a major role in the formation of angiotensin II. 40 Other proteases are known to have functions, which remain to be fully clarified.

The mechanism of chemokine production by ECs stimulated with mast cell tryptase is unclear. One possible mechanism involves activation of protease-activated receptors (PARs). Tryptase or thrombin cleaves the amino-terminal extracellular extension of the intact and inactivated receptor, exposing the amino terminus, which then functions as a receptor agonist, binding to a region of the receptor and activating it. Four subtypes of PAR have been cloned. The thrombin receptor (PAR-1) is expressed on ECs but does not appear to be activated by tryptase. PAR-2 is also expressed on ECs, and it may be activated by tryptase. 41 The effect of human mast cell tryptase on ECs inducing the production of chemokine may be mediated by this receptor. PAR-3 and PAR-4 can also be cleaved by thrombin. 42 However, little is known about the relationship between tryptase and these receptors.

In summary, we found that MCGs upregulate the secretion and gene expression of MCP-1 and IL-8 in human ECs. Human mast cell tryptase, but not chymase, is involved in the MCG-induced production of these chemokines. These results suggest that mast cells contribute to the pathogenesis of cardiovascular disorders, for instance by stimulating EC production of chemokines and enhancing local inflammation.

This work was supported by a research grant from the Ministry of Health and Welfare of Japan and a grant-in-aid for general scientific research from the Ministry of Education, Science, Sports, and Culture of Japan.


Molecular organization of rat prolactin granules: in vitro stability of intact and "membraneless" granules

Studies carried out on a number of secretory cell systems suggest that the specific cytoplasmic granules in which the secretion products are stored before their release are complex organelles which can possess a distinct molecular organization. For instance, it has been reported that in some granules the segregated secretion products are organized into crystalline structures (1-3) or large intermolecular aggregates (4-8). It is likely that all phenomena of this type are favorable to the economy of the cell, in the sense that they reduce the energy required for storage of the secretion products. The prolactin (LTH) granules of the rat pituitary possess a number of morphological features which strongly suggest that the molecules(s) of their content might be arranged in a relatively stable structure. Thus, these granules are remarkably polymorphic in shape, and their membrane is usually separated from their content by a clear space. Furthermore, identifiable LTH granules devoid of their membrane are often seen in the pericapillary space, suggesting that upon discharge by exocytosis they are dissolved only slowly (9). However, no studies specifically concerned with the mechanisms of LTH storage have been reported so far. In order to obtain some information on this question, we have studied the behavior of isolated granule fractions incubated in vitro under a variety of carefully controlled experimental conditions.


Studies on Morphological Changes and Histamine Release Induced by Bee Venom, n-Decylamine and Hypotonic Solutions in Rat Peritoneal Mast Cells

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Resumo

Histamine release and concomitant morphological changes in rat peritoneal mast cells were studied under various conditions. It was found that mast cells react somewhat differently, depending on the means by which histamine release was brought about. Bee venom produced effects similar to those of compound 48/80 and seemed to trigger an active cell process with extrusion of mast granules as a final result. n-Decylamine and hyposmotic solutions appeared to bring about histamine release by affecting the integrity of mast cell fine structure resulting in a breakdown of plasma membrane and cellular compartments.


GAGs and mast cell proteases

The proteases specific to mast cell granules are chymases, tryptases and carboxypeptidase A3 in human mast cells there is one chymase and a limited repertoire of tryptases compared with the numerous mouse enzymes [2]. In addition to these, several other proteases occur in mast cell granules but are not specific to them examples are cathepsin G, granzyme B [2], and cathepsin E, which cleaves the carboxypeptidase A precursor to give the active enzyme [38]. Proteases in mast cell granules are stored in their active forms [39]. The functions of mast cell proteases in inflammation and tissue repair [40], and those of protease-proteoglycan complexes in innate immunity [41] have been reviewed. These proteases are well recognised as pharmacological targets [42].

Mast cell protease storage is dependent on serglycin, and is moreover dependent on the presence of heparin and/or chondroitin, as demonstrated in NDST2 −/− mice that do not make the fully sulphated heparin structure [43, 44] and GalNAc4S-6OST −/− mice that cannot generate the CS-E structure [45]. No evidence has been reported that fully anticoagulant heparin, containing the 3-OST product sequence, is necessary for protease storage. Mouse CTMCs deficient in a combination of proteases have much reduced heparin, but unaltered chondroitin content [46]. Protease deficient, serglycin deficient, and heparin deficient mast cells all display altered granule morphology [43, 44, 46, 47].

In the mast cell granule, proteases and heparin are in intimate contact, so extensive heparin binding sites containing basic residues are expected on the surfaces of the proteases. For tryptases, dependent on heparin for activity and stabilisation of the tetrameric form [48], a plausible cross-linking geometry has been described for human β-II tryptase [49] (Fig. 4a) and a potentially heparin-binding linear area of basic character has been identified across two monomeric units in the tetramer of human α1-tryptase (Fig. 4b) [50]. Besides the active tetrameric form, stabilised by heparin, tryptases such as human β-tryptase and mouse mMCP-6 can also form active monomers in the presence of heparin, even if the heparin chain is too small to bridge two protein monomers (though heparin of such a low molecular weight is not likely to be found na Vivo) [51, 52]. The minimum length of heparin for complex formation with tryptase tetramer is 20 monosaccharides [53]. The substrate selectivities for monomeric and tetrameric tryptases are different, and the monomeric form is susceptible to inhibition by protein inhibitors such as BPTI [51] in the tetrameric form the active sites of the four monomers face each other round a restricted space in the centre of the complex, restricting access to inhibitors that are proteins.

Heparin interactions with proteases uma A β-tryptase tetramer crystal structure (1A0L.pdb), coloured by charge where blue is positive and red negative. This view clearly shows the restricted central active site. Clusters of basic residues, coloured blue, might accommodate a heparin chain binding to two monomers and so stabilising the active tetramer. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc. b An α-tryptase tetramer crystal structure (1LTO.pdb), turned over by 90° to show the equivalent of the top face as compared with A). This view shows an almost continuous line of basic amino acid residues aligning with a long heparin molecule, shown in ball and stick format. Reproduced from [50] with permission. c A chymase monomer crystal structure (4KP0.pdb), showing clusters of basic amino acid residues (blue) on opposite sides of the charge-coloured surface, with a cluster of acidic residues (red) between them. The orientation of these two basic patches on the surface of chymase might allow this enzyme to pack between heparin chains of serglycin. The active site groove is on the left face of this diagram. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc. d A granzyme B monomer crystal structure (1IAU.pdb) showing a substantial cluster of basic residues (blue) at the top of the charge-coloured surface. The active site is on the left face of the diagram. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc

As the tetramer is most stable at low pH and in the presence of heparin, it has been proposed that tryptases are stored in the tetrameric form [54], and the presence of two separate, linear heparin binding sites on each tetramer, requiring long heparin chains, is compatible with the formation of closely packed complexes with heparin chains attached to a serglycin core. Depolymerisation of heparin, degranulation, and rise in pH could dissociate the tetramers to give heparin-activated, effective monomers, or inactive monomers as the heparin dissociates over time.

It is interesting to note that antithrombin is capable of inhibiting the monomeric active form of tryptase [55] so heparin can either activate the serine protease or potentiate its inhibition if all three are found together. Tetrameric, heparin-associated human tryptase can prevent coagulation and formation of fibrin deposits in inflamed tissue by cleaving fibrinogen [56].

For human chymase and granzyme B, typical heparin/HS binding sites can be identified. Chymase is active as a monomer, and does not require heparin for its activity. It has two separate well-defined patches of basic residues that may constitute heparin-binding sites, on opposite faces of the protein surface (Fig. 4c). There is only one human chymase (rodents have several), and its presence or absence determines the classification of human mast cells into MCTC mast cells, positive for both tryptase and chymase, and MCT cells, positive for tryptase only [2]. These two cell types are considered approximately equivalent to rodent CTMCs and MMCs, respectively. It is likely that this classification is an oversimplification of the true situation, at least in tissues like the lung [57]. Granzyme B has a particularly clear basic patch, shown on the protein surface in Fig. 4d. All of these potential heparin binding sites on the proteases have different sizes and shapes they may have different affinities for heparin, different abilities to bind to more than one heparin chain in the granule, different requirements in terms of heparin chain length, and even possibly different preferences for fine structure within heparin. It is also possible, of course, that preferences for CS/DS structures vs heparin structures differ between proteases.


Métodos

Estoque e embriões de peixe-zebra

O peixe-zebra foi acasalado, encenado e criado conforme descrito anteriormente 14 e mantido de acordo com as diretrizes do Comitê de Uso e Cuidado Institucional de Animais da Universidade da Califórnia, San Diego ou do Comitê de Uso e Cuidado Institucional de Animais da Universidade Estadual do Oregon. As linhagens transgênicas Tg (gata2: eGFP) la3 15 e Tg (mpx: eGFP) i113 16 foram usados.

Preparação de células

As suspensões de células únicas de WKM e baço foram preparadas a partir de peixe-zebra adulto conforme descrito. 15 O sangue foi obtido por punção cardíaca com pontas heparinizadas após óbito em tricaína. Células de exsudato intraperitoneal (IPEX) foram coletadas por meio de lavagem com solução salina tamponada com fosfato (PBS Mediatech). Quatro lavagens sequenciais usando 5 μL de PBS foram realizadas usando uma seringa de 10 μL (Hamilton) para um volume total de 20 μL. As suspensões de células únicas de outros órgãos foram preparadas por trituração manual e filtração. As contagens de células foram realizadas em hemacitômetro (Hausser Scientific), utilizando Trypan Blue (Invitrogen).

Citometria de fluxo

As células foram examinadas usando um citômetro de fluxo LSRII (BD Biosciences) como descrito anteriormente. 15,17 Os dados foram analisados ​​usando o software FlowJo versão 9.0.2 (TreeStar). As células foram purificadas usando um FACSAria I (BD Biosciences).

Citologia

As citospinas foram realizadas conforme descrito 15 usando um Shandon Cytospin-4 (Thermo Fisher Scientific). As células foram fixadas e coradas com hematoxilina e eosina (Thermo Fisher Scientific), Wright-Giemsa (WG), mieloperoxidase (MPX), ácido periódico-Schiff (PAS) ou azul de toluidina (TB) de acordo com as instruções do fabricante (Sigma-Aldrich ) Esfregaços de sangue foram corados com PAS, com hematoxilina como contracoloração.

Microscopy

Citospins foram fotografados usando um microscópio DP70 (Olympus America). Para microscopia eletrônica de transmissão (TEM), as células foram fixadas em glutaraldeído a 3% em tampão cacodilato 0,1M. As células foram incorporadas em 12% de gelatina / PBS e sedimentadas. Os pellets de gelatina foram fixados em tetróxido de ósmio tamponado a 1%, lavados e desidratados em uma série graduada de etanol e submetidos à transição para óxido de propileno. As amostras foram incluídas em Embed 812 / Araldite (Ciências de Microscopia Eletrônica). Seções finas (60 nm) foram cortadas e montadas em grades revestidas de parlodion e coradas com acetato de uranila e citrato de chumbo para exame em um microscópio eletrônico Philips-CM100 (Philips / FEI) a 80 kV. As imagens foram obtidas em câmera Megaview-III (Olympus America) e processadas em Adobe Photoshop CS.

Reação em cadeia da polimerase quantitativa em tempo real

O RNA foi obtido usando Trizol (Invitrogen) de acordo com as instruções do fabricante. A contaminação genômica foi evitada pelo tratamento com DNAse (Roche Diagnostics). O cDNA foi preparado usando um kit Superscript-III First-Strand (Invitrogen) com uma reação de controle separada sem transcriptase reversa. A reação em cadeia da polimerase quantitativa foi realizada usando master mix Brilliant SYBR Green (Stratagene) e um sistema Mx3000P (Stratagene). As amostras foram amplificadas em triplicado. O tamanho do produto de reação foi confirmado por eletroforese em gel. Os primers foram projetados com o software Primer3 Versão 0.4.0 18 ou conforme indicado (ef1α, 19 gata2, 19 e mpx 19 ). dr-rnasel2: para frente, TTCTGGGCTTTATTCACAAC reverso, TGAAAGAGAAGCTGAAGACC gcsfr, para a frente, TGAAGGATCTTCAACCACAC reverso, GGGAATTATAGGCCACAAAC ccr9, para a frente, AACCTCACTCACTCCTCAAAC reversa, CAGACCACCAGAGTGTTACC mhc2dab, para a frente, CAGGCCTACTTGCATCAATTG reverso, CAGACCAGATGCTCCGATG.

Preparação do HpAg

Seis camundongos Swiss Webster fêmeas (20 g, 6-8 semanas de idade) foram inoculados com 150 H polygyrus larva de terceiro estágio (L3) em água bidestilada com filtro de 0,1 μm (DDH2O). No dia 22 após a infecção, os camundongos foram mortos e os intestinos delgados foram removidos e cortados em 3 seções em NaCl 0,15 M e incubados a 37 ° durante 2 horas. Adulto H polygyrus (& gt 200) foram transferidos com uma pestana para DDH2O em um tubo de microcentrífuga, sedimentado por 45 segundos a 300g, lavado e repelletado. Os adultos foram congelados em nitrogênio líquido e armazenados a -80 ° C. Os extratos foram preparados usando um sonicador (Sonifier 450 Branson), e as suspensões resultantes foram centrifugadas a 4000g e esterilizado 0,22 μm filtrado (Millipore). A concentração de proteína foi determinada usando o ensaio de proteína de ácido bicinconínico (Pierce Chemical). Os extratos foram armazenados a -80 ° C.

Ensaio de Degranulação

As células foram distribuídas em uma placa de 96 poços e incubadas por 2 horas a 32 ° C e 5% de CO2 com meio 20 contendo HpAg ou PBS, ou lisado com 0,2% de Triton-X gata2: eGFP as células hi foram semeadas a 1 × 10 5 células / mL. Os sobrenadantes livres de células foram coletados e adicionados a 500 μL de o-fenilenodiamina (OPD) (Sigma-Aldrich) em tampão fosfato-citrato 0,05 M e peróxido de hidrogênio 30% para avaliar a desgranulação. 21 As reações foram interrompidas após 10 minutos com H 4M2TÃO4, e testado por espectrofotometria (SPECTRAmax PLUS384) a 492 nm.

Ensaio de sensibilização

Transgênico gata2: eGFP os animais foram imunizados semanalmente por injeção intraperitoneal com 2 μg de papaína (Sigma-Aldrich), ou 0,5 μg de HpAg, emulsionado em adjuvante incompleto de Freund (IFA Sigma-Aldrich), seguido por outra injeção intraperitoneal com antígeno emulsionado um dia antes da coleta de tecidos, após 1 ou 4 semanas. Os peixes de controle foram tratados por injeção intraperitoneal com PBS em IFA (veículo) ou deixados sem tratamento (não injetados). As suspensões de células únicas de baço e sangue de peixes tratados e não tratados foram preparadas conforme descrito em "Preparação de células".

P tomentosa ensaio de infecção

P tomentosa infecção de peixe-zebra adulto foi realizada conforme descrito anteriormente. 8 Os peixes foram desmineralizados e secções histológicas de peixes individuais foram preparadas, com lâminas sendo coradas com PAS para identificar eosinófilos. A infecção foi confirmada pela observação da presença de larvas em desenvolvimento no epitélio intestinal e lúmen. Os eosinófilos foram quantificados pela contagem de todas as células PAS + nucleadas visíveis em 25 campos individuais de alta potência (ampliações de 1000 ×) do trato gastrointestinal de animais infectados e não infectados.

Estatisticas

Os dados foram analisados ​​com estudante bicaudal t testes. As diferenças foram consideradas significativas em P valores menores que 0,05.


Molecular cloning of human cathepsin G: structural similarity to mast cell and cytotoxic T lymphocyte proteinases

Visualizações de artigos são a soma compatível com COUNTER de downloads de artigos de texto completo desde novembro de 2008 (PDF e HTML) em todas as instituições e indivíduos. Essas métricas são atualizadas regularmente para refletir o uso nos últimos dias.

As citações são o número de outros artigos que citam este artigo, calculado pelo Crossref e atualizado diariamente. Encontre mais informações sobre contagens de citações Crossref.

O Altmetric Attention Score é uma medida quantitativa da atenção que um artigo de pesquisa recebeu online. Clicar no ícone do donut carregará uma página em altmetric.com com detalhes adicionais sobre a pontuação e a presença nas redes sociais para o artigo fornecido. Encontre mais informações sobre a pontuação de atenção altmétrica e como a pontuação é calculada.

Observação: Em vez de um resumo, esta é a primeira página do artigo.


Assista o vídeo: Diagnóstico e Tratamento da Refratariedade Plaquetária Imunológica (Fevereiro 2023).